Introduction
The farming and commercialization of genetically modified (GM) crops has
massively increased worldwide since the
first commercialization of GM crop in 1996. In 2018, GM crops are grown
in 26 countries on 191.7 million hectares, which has been increased by more
than 113 folds (ISAAA 2018). Soybean is the first GM crop commercially grown by
large scale and it is still the largest GM crop in cultivation now. As the
production of GM crops is increasing year by year, the potential risks of GM
crops to the environment and food safety have drawn more and more attention
from the international community and the general public (Aqeel et al. 2019). International regulatory
agencies are making efforts to supervise the release of GM crops and many GM
labeling regulations have been established by different countries and groups to
protect the public's right to information and the trade interests of
agricultural products (Li et al. 2016). Therefore, the development of
rapid and effective GM testing assays has become a requirement for
implementation of the law and regulations (Zhang et al. 2015).
Up to now, detection of GM products
is mainly based on PCR technology (Wang et al. 2018), including regular PCR, multiplex PCR (Mazur et al. 2017; Cottenet et al. 2019), qPCR (Guertler et al. 2019; Verginelli et al. 2019), and ddPCR (Niu et al. 2018; Bogožalec-Košir et al. 2019). Recently, isothermal amplification technology has also been
employed in GMO detection, such as LAMP (Loop-mediated isothermal
amplification) (Long et al. 2019) and RPA (Recombinase Polymerase Amplification) (Xu et al. 2014). The methods mentioned above have various limits in accuracy, cost
and efficiency. Nowadays, with more and more GM events are continuously
approved for commercial cultivation by countries each year (Simeon et al. 2005), the establishment of an accurate,
rapid, high-throughput GM crop detection system is in high demand (Fu et al. 2017b). MF-RT-PCR (multi-fluorescence real-time PCR) has the advantage of
harboring many pairs of primers and TaqMan probes labeled with different
fluorescence in a single reaction to amplify multiple fragments in one tube. As
this method has the benefits of saving time and cost, it has been widely used
in the gene diagnosis field, for example, microbial detection (Wang et al. 2017; Zhang et al. 2020). MF-RT-PCR assays have also been reported for screening and
detecting GM crops since 2002. Bhoge and associates used MF-RT-PCR assay to
detect GM maize events, Bt11, Bt176, MON89034, MON810, and GA21 (Bhoge et al. 2016). As another example, 14 targets of transgenic maize, including 7
common GM screening elements, 6 transgenic maize events, and a maize reference
gene were identified by MF-RT-PCR (Wei et al. 2018). Multiplex droplet digital PCR protocols for quantification of GM
maize events, Bt11, MON810, MON863, NK603, 59122, DAS1507, MIR604, GA21,
MON89034, MIR162, MON8017, T25, and endogenous hmgA gene has been successfully established (Dobnik et al. 2018). Currently, MF-RT-PCR based
methods have been widely used in screening elements or target genes in GM rice
and maize but rarely in detecting GM soybean lines. The objectives of this
study are to: 1), establish a multiplex real-time PCR assay for GM soybean
detection; 2), utilize the assay to identify seven commercialized GM soybean
lines. The method we established in this paper could serve as a novel method to
detect GM soybean lines for the purpose of food safety supervision and GM
soybean verification.
Materials and Methods
GM materials
The seeds of transgenic soybean events (GTS40-3-2, MON89788, CV127,
A5547-127, A2704-12, 305423, 356043) were kindly provided by the Institute of
Crop Science, Chinese Academy of Agricultural Sciences (Beijing, China).
Non-transgenic soybean seeds were purchased from local market (Changchun,
China) and validated to be GM-free by our laboratory.
To determine the specificity of the
method, other GM crop events kindly provided by the corresponding developers
were collected and used, including other 6 transgenic soybean events (MON87701,
MON87708, MON87769, MON87705, FG72, SHZD32), 5 transgenic maize events (BT11,
BT176, MON810, MON863, NK603), 3 transgenic rapeseed events (MS1, RF1, GT73), 4
transgenic rice events (KF-6, KMD, TT51, M12), and 4 transgenic cotton events
(MON531, MON1445, MON15985, LLCOTTON25). Seeds of each pure line and non-GM
crops were grinded into powder for DNA extraction.
DNA extraction
Genomic DNA was extracted and purified using the
DNeasy Plant Mini Kit (QIAGEN) following the user’s guide. The concentration
and purity of extracted DNA were quantified using a NanoDrop ND-8000 spectrophotometer
(Thermo Scientific Ltd., USA). DNA samples were diluted to a final
concentration of 25 ng/µL and stored
at -20℃
before using.
Data analysis
All results were analyzed using the Ct values. The threshold of each
element was set according to the final fluorescence of the negative samples.
The reactions that have a Ct value no more than 38 are regarded as positive
reactions. All results of multiplex fluorescence PCR detection systems were
determined from data of sextuplicate reactions.
Primers and TaqMan
probes
Seven GM soybean event specific genes and one
soybean endogenous Lectin gene are
the targets of our MF-RT-PCR assay. One system named SOY-M1 was developped for
specific detection of GM soybeans MON89788, A2704-12, 3054423 and 356043, and
the second system named SOY-M2 was for the detection of GM soybeans GTS40-3-2,
CV127, A5547-127. The probe of the endogenous Lectin reference gene was labeled with 5-hexachloro-fluorescein
(HEX) on the 5'-end as the fluorescent reporter in both systems. For the SOY-M1
system, the target of MON89788, A2704-12, 305423, the probes of them were
labeled with FAM, CY5, Texas Red, and Quasar705, respectively on the 5'-end as
the fluorescent reporters. For the SOY-M2 system, in which the targets of this
assay are GTS40-3-2, CV127, and A5547, the probes of the target
specific sequences were labeled with FAM, CY5, and TEX, respectively. TAMRA on the 3'-end as the fluorescent quencher dye was used
in all probes in both systems. The primers and probes used in this
research were synthesized by Sangon (Sangon, Shanghai,
China) and the corresponding sequences are listed in Table 1 and 2. All primers
and probes were diluted with an appropriate volume of distilled water, and
stored at -20℃ until use.
Optimization of
MF-RT-PCR conditions
To optimize the MF-RT-PCR reaction systems,
different primer concentrations were used to test the best condition for GM
soybean detection. For SOY-M1 different concentrations of primers/probe to
opitmize the PCR system were shown as A1 to A4 in Table 3, and for SOY-M2 were
B1 to B4. In each system, we used four concentrations of primers, in which the
amount of the corresponding probes were half of the primers. Other component of
the MF-RT-PCR system were described as following.
Amplification
systems and procedure
The real-time PCR assay for
SOY-M1 and SOY-M2 were performed in a final volume of 25 µL that
contains 1×HiTaq probe qPCR mastermix (Apexbio Biotechnology Co., Ltd.,
Beijing, China), template DNA, and primer/probe sets (final concentration shown
in Table 1 and 2). The amount of DNA used in the reaction was 50 ng unless
otherwise specified.
Each reaction
was initially denatured at 95°C for 10 min, followed by 45 cycles of 94°C for
15 sec (denaturation), and 60°C for 1 min (annealing and extension). The
real-time quantitative PCR reactions of SOY-M1 and SOY-M2 were performed
separately on a Bio-Rad CFX96 Real-Time thermal cycler. The real-time
quantitative PCR reactions of SOY-M1 for the endogenous Lectin gene and four specific transgenic soybean target events were
performed together using the HEX, FAM, CY5, TexasRed, and Quasar705 channels.
The real-time quantitative PCR reactions of SOY-M2 for the endogenous Lectin gene and the other 3 specific
transgenic soybean events were performed together using the HEX, FAM, CY5, and
Texas Red channels. Fluorescence signals were monitored and analyzed at the
annealing and extension steps during every PCR cycle using CFX Manager Version
1.6 (Bio-Rad, Hercules, USA). Results were analyzed using the software Opticon
Monitor_ 2 version 2.02 (MJ Research, Waltham, M.A., U.S.A.).
Specificity test
of MF-RT-PCR
The specificity of the SOY-M1 and SOY-M2 systems
were evaluated using GM soybean events and other GMOs events, including 13 GM
soybean events, mixture of 5 GM maize events, mixture of 4 GM rice events,
mixture of 4 GM cotton events, and mixture of 3 GM rapeseed events. The content
of each GM event is 1%. Non-GM soybeans were used as a negative control.
Sensitivity test
of MF-RT-PCR
The GM samples of SOY-M1 system were firstly prepared by mixing GM
soybean powder of MON89788, A2704-12, 305423, 356043 in equal proportions, and
the GM samples of SOY-M2 system were mixed with GTS40-3-2, CV-127, and A5547-127. The samples we used in sensitivity test
containing target soybean events were formulated by the mass ratio of the mixed
GM samples of SOY1 and SOY2 with non-transgenic soybean seed powders
respectively to make 25, 6.25, 1.56, 0.4, 0.2, 0.1, 0.05, 0.025 and 0.01% of
each transgenic soybean event. The preparation procedure was carried out in
accordance with standard material candidate process (Chinese Ministry of
Agriculture Bulletin No. 1782-Technical specifications of preparation of the
GMO standard materials). DNA samples were extracted and
diluted to a final concentration of 25 ng/µL and stored at -20℃ before using. The sensitivity of
multiplex fluorescence PCR detection system was determined by SOY-M1 and SOY-M2
multi-PCR amplifications, 6 parallels reactions of each sample.
Applicability test
of MF-RT-PCR
The DNA samples used in applicability test of MF-RT-PCR system was
prepared by mixing one or some of the GM soybean DNA including MON89788,
A2704-12, 305423, 356043, GTS40-3-2, CV-127, A5547-127 with the non-GM soybean DNA by the mass
ratio. All the samples containing the target soybean DNA were 0.2%. The
reaction system of SOY-M1 and SOY-M2 contains 50 ng DNA as template. 6
parallels of each sample were tested.
Results
Establishment of
MF-RT-PCR
To establish the MF-RT-PCR system to detect the 7 soybean events, we
used the specific primer/probe sets for each of these events as shown in Table
1 and 2. Due to the limit of the fluorescence signals channels, we divided the PCR test into
two groups. One is named SOY-M1 specific to MON89788, A2704-12, 305423 and
356043 soybean events, and the other is named SOY-M2 specific to GTS40-3-2,
CV127, and A5547-127. Both detection systems included endogenous soybean gene Lectin. Four different final
concentrations of primer/probe sets A1 to A4 as shown in Table 3 left were used
in the amplification to optimize the MF-RT-PCR system of SOY-M1. It showed that
A1 to A4 reactions were generated with the samples mixed by 0.1% DNA of
MON89788, A2704-12, 305423, and 356043 soybean events. In SOY-M1, with the A1
primer/probe concentration, the soybean events 356043, 305423, and MON89788
could not be amplified. Neither A3 nor A4 could amplify the soybean events
356043. Only A2 succeeded amplifying all these 4 target soybean events (MON89788, A2704-12, 305423, 356043) and the soybean endogenous Lectin gene. The entire test was
repeated four times, and the mean Ct value of these four transgenic events
under the A2 condition was no more than 38.0. So the final primer
concentrations for Lectin, MON89788,
A2704-12, 305423, and 356043 were determined to be 0.6, 0.8, 0.6, 0.4 and 0.4 µmol/L, respectively in SOY-M1 (Fig. 1A).
Similarly, as it was shown in Fig. 1B (right), four primers/probe
concentrations (B1, B2, B3 and B4) for the 3 transgenic soybean events
(GTS40-3-2, CV127, and A5547-127) were tested in the SOY-M2 system. By the same
way, we found the optimal primer/probe concentration for Lectin, GTS40-3-2, CV127, and A5547-127 was 0.4 µmol/L under the B2 condition. All these
three target transgenic events (GTS40-3-2, CV127 and A5547-127) were amplified
under the B2 condition. Correspondingly, the probe concentration in both SOY-M1
and M2 was half of the target primers.
Specificity of
MF-RT-PCR
Table 1: SOY-M1 Fluorescence Pentaplex PCR system primers information
|
Primer/Probe |
Final concentration (μM) |
Sequence (5’-3’) |
Amplicon length (bp) |
Reference |
|
Lectin-QF |
0.6 |
TCCACCCCCATCCACATTT |
81 |
Pauli et al. (2001) |
|
Lectin-QR |
0.6 |
GGCATAGAAGGTGAAGTTGAAGGA |
||
|
Lectin-QP |
0.3 |
HEX-AACCGGTAGCGTTGCCAGCTTCG-TAMRA |
||
|
MON89788-QF |
0.8 |
TCCCGCTCTAGCGCTTCAAT |
139 |
Delobel et al. (2013) |
|
MON89788-QR |
0.8 |
TCGAGCAGGACCTGCAGAA |
||
|
MON89788-QP |
0.4 |
FAM-CTGAAGGCGGGAAACGACAATCTG-TAMRA |
||
|
A2704-12-QF |
0.6 |
GCAAAAAAGCGGTTAGCTCCT |
64 |
Mazzara et
al. (2007°) |
|
A2704-12-QR |
0.6 |
ATTCAGGCTGCGCAACTGTT |
||
|
A2704-12-QP |
0.3 |
Cy5-CGGTCCTCCGATCGCCCTTCC-TAMRA |
||
|
305423-QF |
0.4 |
CGTGTTCTCTTTTTGGCTAGC |
93 |
Mazzara et al. (2013) |
|
305423-QR |
0.4 |
GTGACCAATGAATACATAACACAAACTA |
||
|
305423-QP |
0.2 |
TexasRed-TGACACAAATGATTTTCATACAAAAGTCGAGA-TAMRA |
||
|
356043-QF |
0.4 |
GTCGAATAGGCTAGGTTTACGAAAAA |
99 |
Mazzara et al. (2010) |
|
356043-QR |
0.4 |
TTTGATATTCTTGGAGTAGACGAGAGTGT |
||
|
356043-QP |
0.2 |
Quasar705-CTCTAGAGATCCGTCAACATGGTGGAGCAC-TAMRA |
Table 2: SOY-M2
Fluorescence Tetraplex PCR system primers information
|
Primer/Probe |
Final concentration (μM) |
Sequence (5’-3’) |
Amplicon length (bp) |
Reference |
|
Lectin-QF |
0.4 |
TCCACCCCCATCCACATTT |
81 |
Pauli et al. (2001) |
|
Lectin-QR |
0.4 |
GGCATAGAAGGTGAAGTTGAAGGA |
||
|
Lectin-QP |
0.2 |
HEX-AACCGGTAGCGTTGCCAGCTTCG-TAMRA |
||
|
GTS40-3-2-QF |
0.4 |
TTCATTCAAAATAAGATCATACATACAGGTT |
84 |
Mazzara et al. (2007b) |
|
GTS40-3-2-QR |
0.4 |
GGCATTTGTAGGAGCCACCTT |
||
|
GTS40-3-2-QP |
0.2 |
FAM-CCTTTTCCATTTGGG-TAMRA |
||
|
CV127-QF |
0.4 |
AACAGAAGTTTCCGTTGAGCTTTAAGAC |
88 |
Savini et al. (2011) |
|
CV127-QR |
0.4 |
CATTCGTAGCTCGGATCGTGTAC |
||
|
CV127-QP |
0.2 |
CY5-TTTGGGGAAGCTGTCCCATGCCC-TAMRA |
||
|
A5547-QF |
0.4 |
GCTATTTGGTGGCATTTTTCCA |
75 |
Delobel et al. (2009) |
|
A5547-QR |
0.4 |
CACTGCGGCCAACTTACTTCT |
||
|
A5547-QP |
0.2 |
TexasRed-TCCGCAATGTCATACCGTCATCGTTGT-TAMRA |
%20292-298_files/image002.jpg)
Fig. 1: Primer/Probes
concentration optimization in MF-PCR systems using CFX96 System
A1-A4
represents the Ct values obtained by different primers/probe concentrations
combinations in SOY-M1 real-time PCR system targeting specific sequences of the
Lectin, MON89788, A2704-12, 305423,
356043 respectively; B1-B4 represents the Ct values obtained by different
primers/probe concentrations combinations in SOY-M2 real-time PCR system targeting specific sequences of the Lectin,
GTS40-3-2 CV127, A5547-127 respectively. (Concentrations of the primers/probe
used in A1-A4 and B1-B4 are shown in Table 3)
To investigate the specificity of the MF-RT-PCR assay the SOY-M1 and
SOY-M2 were tested by amplifying the genomic DNA of the relevant GM plant
events, including 13 GM soybean events (GTS40-3-2, MON89788, CV127, A5547-127,
A2704-12, 305423, 356043, MON87701, MON87708, MON87769, MON87705, FG72, and
SHZD32), a mixed sample of 5 GM maize events (BT11, BT176, MON810, MON863, and
NK603), a mixture of 4 GM rice events (KF-6, KMD, TT51, and M12), a mixture of
4 GM cotton events (MON531, MON1445, MON15985, and LLCOTTON25), a mixture of 3
GM rapeseed events (MS1, RF1, and GT73). Genomic DNA of the 17 samples was
diluted by non-transgenic soybean DNA to make the content of each GM event 1%.
Non-GM soybean was used as the negative control. The real-time PCR results from SOY-M1 and SOY-M2 showed that
no positive amplification signal was detected from any of those samples except
the target events and the endogenous Lectin gene in which the Ct value were no
more than 40. These data indicated that the
systems are specific to the 7 soybean events and appropriate to detect them (Table 4).
Sensitivity of
MF-RT-PCR
The samples containing 25, 6.25, 1.56, 0.4, 0.2, 0.1,
0.05, 0.025 and 0.01% of the mixed GM soybeans were used in sensitivity test by
SOY-M1 and SOY-M2 system (Table 5). The results showed that all
the samples with soybean components had the Lectin
gene amplified, while MON89788, A2704-12, 305423, 356043, GTS40-3-2, CV127, and
A5547-127 could only be amplified when the transgenic target content was 0.1%
or more. When the transgenic target content was lower than 0.05%, the two
systems were unable to detect except the endogenous gene. The test was repeated
3 times and the results were consistent. The sensitivity tests indicate the
limit of the detection by SOY-M1 and SOY-M2 is 0.1%.
Table 3: Primers concentrations used to optimize the MF-PCR systems
|
Primers |
Four sets
candidate primers concentrations (μmol/L ) used in
SOY-M1 PCR reactions |
Primers |
Four sets
candidate primers concentrations (μmol/L ) used in
SOY-M2 PCR reactions |
||||||
|
A1 |
A2 |
A3 |
A4 |
B1 |
B2 |
B3 |
B4 |
||
|
Lectin gene F/R primers |
0.4a |
0.6 |
0.4 |
0.4 |
Lectin gene F/R primers |
0.4 |
0.4 |
0.6 |
0.4 |
|
MON89788 F/R primers |
0.4 |
0.8 |
0.8 |
0.8 |
GTS40-3-2 F/R primers |
0.8 |
0.4 |
0.8 |
0.6 |
|
A2704-12 F/R primers |
0.4 |
0.6 |
0.4 |
0.6 |
CV127 F/R primers |
0.4 |
0.4 |
0.4 |
0.4 |
|
305423 F/R primers |
0.4 |
0.4 |
0.4 |
0.4 |
A5547-127 F/R primers |
0.4 |
0.4 |
0.4 |
0.4 |
|
356043 F/R primers |
0.4 |
0.4 |
0.6 |
0.6 |
/ |
/ |
/ |
/ |
/ |
a Mean of final
concentration for forward and reverse primers, The final probe concentration is
half of the primer
Table 4: Specificity
test results of the SOY-MI and SOY-M2 systems
|
Samples |
SOY-M1 system |
SOY-M2 system |
|||||||
|
Average Ct and SD (n=3) by Multiple Real-time
PCR |
Average Ct and SD (n=3) by Multiple Real-time
PCR |
||||||||
|
Lectin |
Mon89788 |
A2704-12 |
305423 |
356043 |
Lectin |
GTS40-3-2 |
CV127 |
A5547-127 |
|
|
MON89788 |
23.60 ±
0.03 |
29.01 ±
0.12 |
－ |
－ |
－ |
23.45 ±
0.05 |
－ |
－ |
－ |
|
A2704-12 |
23.84 ±
0.11 |
－ |
29.96 ±
0.13 |
－ |
－ |
23.31 ±
0.04 |
－ |
－ |
－ |
|
305423 |
23.13 ±
0.07 |
－ |
－ |
30.54 ±
0.10 |
－ |
23.30 ±
0.01 |
－ |
－ |
－ |
|
356043 |
23.72 ±
0.16 |
－ |
－ |
－ |
31.30 ±
0.16 |
23.12 ±
0.05 |
－ |
－ |
－ |
|
GTS40-3-2 |
23.94 ±
0.04 |
－ |
－ |
－ |
－ |
23.20 ±
0.05 |
32.13 ±
0.09 |
－ |
－ |
|
CV127 |
23.11 ±
0.03 |
－ |
－ |
－ |
－ |
23.38 ±
0.08 |
－ |
29.37 ±
0.13 |
－ |
|
A5547-127 |
23.20 ±
0.16 |
－ |
－ |
－ |
－ |
23.27 ±
0.05 |
－ |
－ |
30.70 ±
0.10 |
|
MON87701 |
23.86 ±
0.04 |
－ |
－ |
－ |
－ |
23.19 ±
0.06 |
－ |
－ |
－ |
|
MON87708 |
23.32 ±
0.08 |
－ |
－ |
－ |
－ |
23.45 ±
0.04 |
－ |
－ |
－ |
|
MON87769 |
23.80 ±
0.14 |
－ |
－ |
－ |
－ |
23.58 ±
0.07 |
－ |
－ |
－ |
|
MON87705 |
23.46 ±
0.11 |
－ |
－ |
－ |
－ |
23.33 ±
0.16 |
－ |
－ |
－ |
|
FG72 |
23.66 ±
0.09 |
－ |
－ |
－ |
－ |
23.70 ±
0.02 |
－ |
－ |
－ |
|
SHZD32 |
23.41 ±
0.02 |
－ |
－ |
－ |
－ |
23.26 ±
0.10 |
－ |
－ |
－ |
|
GM corn
mixes |
－ |
－ |
－ |
－ |
－ |
－ |
－ |
－ |
－ |
|
GM rice
mixes |
－ |
－ |
－ |
－ |
－ |
－ |
－ |
－ |
－ |
|
GM
cotton mixes |
－ |
－ |
－ |
－ |
－ |
－ |
－ |
－ |
－ |
|
GM
rapeseed mixes |
－ |
－ |
－ |
－ |
－ |
－ |
－ |
－ |
－ |
|
Non-GM
soybean |
23.29 ±
0.09 |
－ |
－ |
－ |
－ |
23.47 ±
0.14 |
－ |
－ |
－ |
-, No amplification was detected.
Table 5: Sensitivity
test results of the SOY-MI and SOY-M2 systems
|
Sample names |
Content of Mon89788 A2704-1 305423 356043 |
Average Ct and SD (n=6) by Multiple Real-time
PCR |
Sample names |
Content of GTS40-3-2 CV127 A5547-127 |
Average Ct and SD (n=6) by Multiple Real-time
PCR |
|||||||
|
Lectin |
Mon89788 |
A2704-12 |
305423 |
356043 |
Lectin |
GTS40-3-2 |
CV127 |
A5547-127 |
||||
|
S1 |
25% |
23.43±0.09 |
23.96±0.31 |
25.36±0.24 |
25.27±0.17 |
25.62±0.31 |
X1 |
25% |
23.39±0.01 |
27.52±0.21 |
26.36±0.05 |
25.51±0.21 |
|
S2 |
6.25% |
24.09±0.16 |
26.68±0.44 |
27.55±0.23 |
27.50±0.27 |
27.82±0.39 |
X2 |
6.25% |
23.86±0.09 |
30.17±0.07 |
29.04±0.10 |
27.95±0.29 |
|
S3 |
1.56% |
24.28±0.05 |
28.71±0.16 |
29.95±0.29 |
29.77±0.44 |
30.35±0.52 |
X3 |
1.56% |
24.14±0.20 |
32.53±0.18 |
31.55±0.18 |
30.16±0.14 |
|
S4 |
0.4% |
23.68±0.09 |
31.01±0.11 |
32.23±0.40 |
32.27±0.37 |
33.08±0.25 |
X4 |
0.4% |
24.33±0.13 |
34.69±0.45 |
33.89±0.36 |
32.30±0.31 |
|
S5 |
0.2% |
23.60±0.22 |
32.96±0.22 |
34.18±0.58 |
33.87±0.73 |
35.47±0.87 |
X5 |
0.2% |
23.76±0.30 |
35.93±0.24 |
35.77±0.59 |
33.64±0.29 |
|
S6 |
0.1% |
23.99±0.59 |
35.07±0.35 |
35.78±0.32 |
35.42±0.72 |
37.11±0.82 |
X6 |
0.1% |
23.80±0.36 |
37.40±0.35 |
36.90±0.30 |
34.82±0.31 |
|
S7 |
0.05% |
23.87±0.30 |
－ |
－ |
－ |
－ |
X7 |
0.05% |
23.96±0.27 |
－ |
38.64±0.51 |
36.29±0.58 |
|
S8 |
0.025% |
23.66±0.85 |
－ |
－ |
－ |
－ |
X8 |
0.025% |
23.87±0.39 |
－ |
－ |
37.70±0.37 |
|
S9 |
0.01% |
23.65±0.10 |
－ |
－ |
－ |
－ |
X9 |
0.01% |
23.78±0.06 |
－ |
－ |
－ |
-, No amplification was detected.
Practical
applicability of MF-RT-PCR
In order to test the practical applicability of these two reaction
systems, we designed a series of sample combinations. First, samples
with 1% of target soybeans including one, any two, any three, or all the four
target soybean events (MON89788, A2704-12, 305423, 356043) were tested by
SOY-M1, shown as Table 6. For SOY-M2 system, the samples containing one, any two, or
all three target soybean events (GTS40-3-2, CV127, and A5547-127) were tested (Table 7). All the samples contained 0.2% of
the target soybean DNA. The results showed all combinations of samples
containing any or all 7 target soybean DNA were well detected by the two
MF-RT-PCR systems. This indicates that these two MF-RT-PCR detection systems
are able to detect the target transgenic soybean events in complex samples.
Discussion
GTS40-3-2, MON89788, CV127, A5547-127, A2704-12,
3054423, and 356043, the first batch of commercialized and cultivated GM
soybean lines, used to occupy more than 80% of the GM soybean planting area of
the world. With the acceleration of globalization and the rapid growth of
international soybean trading, the supervision of GM %20292-298_files/image003.png)
soybean events becomes more and more challenging (Fraiture et al. 2015).
At present, the commonly used molecular detection assays to identify the GM
soybean traits are mainly based on the real-time PCR technique, but these
assays suffer from some shortcomings, such as low detection throughput and high
cost. In this study, SOY-M1 and SOY-M2 systems were established by combining
the endogenous Lectin gene and seven
GM soybean targets to achieve the simultaneous detection of multiple targets,
which could greatly reduce the testing cost, facilitate the experimental
operation, and improve the detection efficiency. In addition, soybean
endogenous genes in both systems can effectively avoid false negative results
caused by operation errors or PCR inhibitors.
It was found that the fluorescent value of the amplification curve of
GTS40-3-2 in SOY-M1 and MON89788 in SOY-M2 were lower than those in other
targets, and it could not be improved by further optimization. This may be
relevant to the low efficiency of amplification of targets in a multiplex
system. However, the specificity, sensitivity, and applicability test results
all showed that the multiplex fluorescence PCR system is sufficient to detect
these two targets accurately.
Compare to other high throughput screening methods, the assay we
established is accurate, reliable, and easy to operate by research institutes,
government agencies, and companies. So far, most of the published multiplex PCR
based detection methods rely on the polymorphism of the product length to
differentiate samples, since the PCR products need to be visualized through
electrophoresis (Shang et al. 2017). Therefore, with those methods,
it is very challenging to design PCR primers to generate products with
appropriate length, and it is time-consuming and expensive to optimize the
experiment. In contrast, the signal from the PCR products in our assay are
collected and processed automatically; therefore, it is timely and cost efficient. Some
techniques based on nested PCR with multi-fluoresce, such as ME-qPCR (Fu et al. 2017a) and MT-PCR (Wei et al.
2018), are able to detect as many as 26 targets simultaneously with the
sensitivity of 0.001 g, which is 100 times more sensitive than our assay.
However, these methods are vulnerable to contamination and false negative. In
addition, a skilled operator is a key factor for the success of the assays due
to the complicated protocols. From this aspect, the MF-RT-PCR developed in this
study is more practical for research institutes, government agencies, and
companies to use. Some
researchers have established multi-fluorescence digital PCR method, which can
detect multiple targets qualitatively and quantitatively. However, the digital
PCR instrument is expensive and requires advanced operators. In summary, the
MF-RT-PCR established in this study is easy to operate and practical to most
users.
Conclusion
The MF-RT-PCR assay established in this study is
accurate, reliable, and efficient, which could greatly enhance the efficiency
of transgenic soybean detection. This assay could serve as a high throughput
approach to detect the target among a large amount of GM soybean lines for the
purpose of food safety supervision and GM soybean verification.
Acknowledgements
This work was supported by the National
Transgenic Plant Special Fund, China (2018ZX08012001), Jilin Agricultural
Technological Innovation Project, China (CXGC2017JQ017). We appreciate the financial support for this
study.
References
Aqeel M, A Noman, T Sanaullah, Z Kabir, M Buriro, N Khalid, W Islam, M
Qasim, MU Khan, A Fida, S Fida, MA Akram, SUR Sabir (2019). Characterization of
genetically modified plants producing bioactive compounds for human health: A systemic review. Intl J Agric Biol
22:1293‒1304
Bhoge RK, R Chhabra, M Singh, M Sathiyabama, G Randhawa (2016). Multiplex
real-time PCR-based detection and quantification of genetically modified maize
events employing SYBR Green I and TaqMan chemistries. Curr Sci 110:1446‒1451
Bogožalec-Košir A, D Štebih,
A Blejec, D Morisset, J Žel (2019). Digital PCR as an effective
tool for GMO quantification in complex matrices. Food Chem 294:73‒78
Cottenet G, C Blancpain, S Véronique, PF Chuah (2019). Two FAST multiplex
real-time PCR reactions to assess the presence of genetically modified
organisms in food. Food Chem 274:760‒765
Delobel C, A Bogni, G Pinski, M Mazzara, GVD Eede (2013). Event Specific
Method for the Quantification of Soybean Line MON89788 using Real-time PCR
v. 1.01. Luxembourg
Delobel C, A Bogni, M Mazzara, GVD Eede (2009). Event-specific Method
for the Quantification of Soybean Line A5547-127 Using Real-time PCR. Joint
Research Centre, Ispra, Italy
Dobnik D, B Spilsberg, AB Košir, D Štebih, D Morisset, A Holst-Jensen, J
Žel (2018). Multiplex droplet
digital PCR protocols for quantification of GM maize events. Meth Mol Biol 1768:69‒98
Fraiture MA, P Herman, I Tavemiers, MD loose, D Deforce, NH Roosens (2015).
Current and new approaches in GMO detection: Challenges and solutions. Biomed Res Intl 2015; Article 392872
Fu W, PY Zhu, S Wei, ZX Du, CG Wang, XY Wu, FW Li, SF Zhu (2017a).
Multiplex enrichment quantitative PCR（ME-qPCR）: a high-throughput, highly
sensitive detection method for GMO identification. Anal Bioanal Chem 409:2655‒2664
Fu W, S Wei, CG Wang, ZX Du, PY Zhu, XY Wu, G Wu, SF Zhu (2017b). A temperature-tolerant ultiple
elements and genes screening system for genetically modified organisms based on dual priming oligonucleotide primers and
capillary electrophoresis. Food Chem
229:396‒402
Guertler P, L Grohmann, H Naumann, M Pavlovic, U Busch (2019). Development
of event-specific qPCR detection methods for genetically modified alfalfa
events J101, J163 and KK179. Biomol
Detect Quantif 17:100076
ISAAA (2018). Global
Status of Commercialized Biotech/GM Crops: Biotech Crops Continue to Help Meet the Challenges of Increased
Population and Climate Change. Available at : http://www.isaaa.org/resources/publications/briefs/54/default.asp
Li YJ, T Xiong, HW Wu, YZ Yang (2016).
Visual DNA microarray coupled with Multiplex-PCR for the rapid detection of
twelve genetically modified maize. Biochip
J 10:42‒47
Long LK, W
Yan, CC Li, W Xia, ZJ Xing, N Liu, LM Dong, FW Li (2019). Rapid visual
detection of four specific transgenic events in GM soybean using loop-mediated
isothermal amplification method. Russ J
Plant Physiol 66:646‒655
Mazzara M, B Munaro, E Grazioli, C Savini, C Charles-Delobel, GVD Eede
2013. Event-specific Method for the Quantification of Soybean Event
DP-305423-1 Using Real-time PCR v1.01. Joint Research Centre, Ispra, Italy
Mazzara M, B Munaro, E Grazioli, C Savini, C Charles-Delobel, GVD Eede
(2010). Event-specific Method for the Quantification of Soybean Event
DP-356043-5 Using Real-time PCR v1.01. Joint Research Centre, Ispra, Italy
Mazzara M, C Delobel, E Grazioli, S Larcher, C Savini, GVD Eede (2007a). Event-specific
Method for the Quantification of Soybean Line A2704-12 Using Real-time PCR.
14 May 2007. Joint Research Centre Ispra, Italy
Mazzara M, B Munaro, S Larcher, E Grazioli, C Charles-Delobel, C Savini, GVD
Eede (2007b). Event-specific Method for the Quantification of Soybean Line
40-3-2 Using Real-time PCR. Joint Research Centre, Ispra, Italy
Mazur M, Z Sieradzki, B Król, K Kwiatek (2017). Multiplex PCR assays for qualitative detection and
identification of the GT73, Ms8, Rf3 and T45 varieties of genetically modified
oilseed rape. J Anim Feed Sci 26:148‒156
Niu C, Y Xu, C Zhang, PY Zhu, KL Huang, YB Luo, WT Xu (2018).
Ultrasensitive single fluorescence-labeled probe-mediated single universal
primer- multiplex-droplet digital polymerase chain reaction for high-throughput
genetically modified organism screening. Anal
Chem 90:5586‒5593
Pauli U, M Liniger, M Schrott, B Schouwey, P Huebner, P brodman, A Eugster (2001).
Quantitative detection of genetically modified soybean and maize: Method evaluation in a Swiss ring trial. Mitteil Lebensm Hyg 92:145‒158
Savini C, M Mazzara, G Pinski, GVD Eede (2011). Event Specified Method
for the Quantification of Soybean CV127 by Real-time PCR. Joint Research
Centre, Ispra, Italy
Shang Y, WT Xu, Y Wang, YC Xu, KL Huang (2017). Novel multiplex qualitative
detection using universal primer-multiplex-PCR combined with pyrosequencing. Food Chem 237:773‒778
Simeon KO, EW Gachomo, M Mwangi (2005). Commercial production of
genetically modified crops: A prognosos towards global acceptance. Intl
J Agric Biol 7:681‒688
Verginelli D, A Paternň, ML De-Marchis, C
Quarchioni, D Vinciguerra, P Bonini, S Peddis, C Fusco, M Misto, C Marfoglia, F
Pomilio, U Marchesi (2019). Development and comparative study of pat/bar real-time PCR assay for
integrating the screening strategy of a GMO testing laboratory. J Sci Agric100:2121–2129
Wang C, Q Wang, J Hu, H Sun, J Pu, J Liu, Y Sun (2017). A multiplex RT-PCR assay
for detection and differentiation of Avian-Origin Canine H3N2，Equine-Origin H3N8，Human-Orgin H3N2，and H1N1/2009 Canine influenza
viruses. PLoS One 12; Article
e0170374
Wang FJ, JL Feng, SD Ye, HN Huang, XL Zhang (2018). Development of a
multiplex fluorescence quantitative PCR for detection of genetically modified
organisms. Biologia 73:21‒29
Wei S, CG Wang, PY Zhu, GB Zhou, W Fu (2018). A high-throughput multiplex
tandem PCR assay for the screening of genetically modified maize. LWT-Food Sci Technol 87:169‒176
Xu C, L Li, WJ Jin, YS Wan (2014). Recombinase polymerase amplification (RPA) of
CaMV-35S Promoter and nos terminator rapid detection of genetically modified
crops. Intl J Mol Sci 15:18197‒18205
Zhang MH, YB Yu, XJ Guo, KJ Zhang, FX Luan, YM Zhu, B Qu (2015).
Event-specific quantitative detection of genetically modified wheat B72-8-11
based on the 3’flanking sequence. Eur
Food Res Technol 240:775‒782
Zhang Y, L
Cao, Z Xu, P Zhu, B Huang, K Li, Y Xu, Z Zhang, Y Wu, B Di (2020). Evaluation of a
multiplex PCR assay for detection of respiratory viruses and Mycoplasma pneumoniae in oropharyngeal
swab samples from outpatients. J Clin Lab Anal 34; Article e23032